Search Thermo Fisher Scientific
AGCTGGGATGTACCTGGAGAGATAG[C/G]GGGTAGTTCTCCCTACTGCCCAGGC
Species: |
Human |
dbSNP Submissions: |
NA
|
Phenotype: |
![]() ![]() ![]() ![]() |
Literature Links: |
CUTA PubMed Links |
Allele Nomenclature: |
|
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
CUTA - cutA divalent cation tolerance homolog (E. coli) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014433.2 | 1860 | Intron | NP_001014433.1 | |||
NM_001014837.1 | 1860 | Intron | NP_001014837.1 | |||
NM_001014838.1 | 1860 | Intron | NP_001014838.1 | |||
NM_001014840.1 | 1860 | Intron | NP_001014840.1 | |||
NM_015921.2 | 1860 | Intron | NP_057005.1 |
KIFC1 - kinesin family member C1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHF1 - PHD finger protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002636.4 | 1860 | UTR 3 | NP_002627.1 | |||
NM_024165.2 | 1860 | UTR 3 | NP_077084.1 | |||
XM_011514662.1 | 1860 | UTR 3 | XP_011512964.1 | |||
XM_011514663.1 | 1860 | UTR 3 | XP_011512965.1 | |||
XM_011514664.1 | 1860 | UTR 3 | XP_011512966.1 | |||
XM_011514665.1 | 1860 | UTR 3 | XP_011512967.1 | |||
XM_011514666.1 | 1860 | UTR 3 | XP_011512968.1 | |||
XM_011514669.1 | 1860 | UTR 3 | XP_011512971.1 | |||
XM_011514670.2 | 1860 | Intron | XP_011512972.1 | |||
XM_017010939.1 | 1860 | UTR 3 | XP_016866428.1 |
SYNGAP1 - synaptic Ras GTPase activating protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
![]() |